Antitumor Potential of Fibulin-5 in Breast Cancer Cells Depends on Its RGD Cell Adhesion Motif
Yamina Mohamedia,b Tania Fontanila,b,c Teresa Coboc,d José A. Vegae,f
Juan Luis Coboe,g Marcos Pérez-Basterrecheah Juan Coboc,d
Álvaro J. Obayab,i Santiago Cala,b
aDepartamento de Bioquímica y Biología Molecular, Universidad de Oviedo, Asturias, bInstituto Universitario de Oncología, IUOPA, Universidad de Oviedo, Asturias, cInstituto Asturiano de Odontología, Oviedo, Asturias, dDepartamento de Cirugía y Especialidades Médico-Quirúrgicas, Universidad de Oviedo, Asturias, eDepartamento de Morfología y Biología Celular, Facultad de Medicina, Universidad de Oviedo, Asturias, Spain, fFacultad de Ciencias de la Salud, Universidad Autónoma de Chile, Santiago, Chile, gServicio de Cirugía Maxilofacial. Hospital Universitario Central de Asturias (HUCA), hUnidad de Terapia Celular y Medicina Regenerativa, Servicio de Hematología y Hemoterapia, Hospital Universitario Central de Asturias, Oviedo, Asturias, iDepartamento de Biología Funcional, Area de Fisiología, Universidad de Oviedo, Asturias, Spain.
Key Words
Fibulin • Breast cancer • Tumor microenvironment • RGD motif
Abstract
Background/Aims: Different components of the tumor microenvironment can be either tumor-promoting or tumor-suppressive agents depending on factors which are not fully understood. Fibulins are components of the extracellular matrix from different tissues and constitute a clear example of this dual function. In fact, fibulins may either support tumor growth or abolish progression of malignant cells depending on the crosstalk between tumor cells and their surrounding stroma through mechanisms that remain to be elucidated. Among all fibulins, fibulin-5 contains a particular structural hallmark which consists in the presence of a RGD motif within its architecture. Previous reports have highlighted the importance of the interaction of this motif with integrins, and not only in normal functions but also in a tumor context. Methods: Site-Directed Mutagenesis technique was employed to introduce the change RGD to RGE (RGD-to-RGE) within Fbln5 cDNA sequence. Cell proliferation was measured using the MTT assay or by counting Ki-67 positive cell nuclei. Cell adhesion was analysed using culture plates coated with different extracellular matrix components. Cell invasion was evaluated using 24-well Matrigel-coated invasion chambers, and mammosphere formation was monitored using ultralow attachment culture plates. BALB/c mice were employed to induce subcutaneous tumors. Results: The RGD-to-RGE change alters the capacity of breast cancer cells to adhere to different extracellular matrix proteins as well as to αvβ3 and α5β1 integrins, and promotes protumor effects using different cell-based assays. Moreover, 4T1 cells, a mouse breast cancer cell line model, shows an increased capacity to generate tumors when exogenously expresses fibulin-5 with a RGD-to-RGE change, and such capacity is similar to that shown for 4T1 cells with an interfered Fbln5 gene. Conclusion: These data highlight the importance of the RGD motif of fibulin-5 to induce antitumor effects and provide new insights into the involvement of fibulins in tumor processes.
Introduction
Acellular components of the cell microenvironment form a structural framework to give support to cells and tissues. However, this intricate network of complex molecules and sequestered growth factors, known as extracellular matrix (ECM), not only forms an architectural scaffold for cells but also regulates cellular activities that influence processes such as differentiation, proliferation or migration [1]. Functional significance of ECM is illustrated by the number of anomalies associated to its components which lead to the development of pathological conditions, including cancer [2]. In fact, ECM is highly disorganized in tumor processes and can contribute to promote growth and dissemination of malignant cells [3]. However, different ECM components can act as protumor or antitumor factors through mechanisms not fully understood and fibulins exemplify this dual function in tumorigenesis [4, 5]. Originally identified as components of elastic fibers, fibulins play key roles in a wide range of biological processes related to tissue homeostasis and remodeling; and their biological importance is highlighted through the severe deficiencies shown by the mouse models lacking a particular fibulin gene [6]. In relation to cancer, a growing number of studies have revealed that effects of fibulins are complex and variable dependent on different factors [5].
Fibulin-5, also known as EVEC and DANCE, constitutes a clear example of the importance of fibulins in those processes. This 66-kDa glycosylated protein contains different motifs within its structure involved in the interaction with other ECM proteins [7, 8]. Generation of the mouse deficient in fibulin-5 coding gene, Fbln5, revealed its importance in biological functions [9, 10]. Although Fbln5-deficient mice survive to adulthood, they develop severe abnormalities derived from elastic fiber defects, including genital prolapse, emphysematous lungs and cutis laxa. Regarding to tumor processes, both protumor and antitumor roles have been associated to fibulin-5, which seem to be context-dependent [11]. For instance, levels of FBLN5 messenger RNA were found downregulated in a variety of human tumor samples [11]; and fibulin-5 inhibits invasion of bladder [12] and lung [13, 14] cancer cells through different mechanisms. These findings suggest a tumor-suppression function for fibulin-5. In stark contrast, fibulin-5 mediates lung metastasis in a rat model of renal cell carcinoma [15] and also induces nasopharyngeal carcinoma cell metastasis [16]. Furthermore, fibulin-5 is associated to EMT in breast [17] and cervical cancer cells [18], via TGF-β and Nogo-B dependent-mechanisms respectively.
We have previously reported the tumor-suppressive effects of the exogenous fibulin-5 expression in breast cancer cells [19]. Taking into account that fibulin-5 is the only member of the fibulin family containing a RGD integrin binding motif [7], and the importance of this motif not only in normal physiological conditions but also in tumorigenesis [20], we wanted to investigate whether the RGD-to-RGE change could affect behavior of the murine 4T1 and the human MDA-MB-231 breast cancer cell lines. Our data show a potent protumor activity of cells expressing a recombinant fibulin-5 containing this change, and provide new insights into the significance of fibulin-5 in tumor processes.
Materials and Methods
Cells lines and cell culture conditions
Human MDA-MB-231 and murine 4T1 breast cancer cell lines were kindly provided by Dr. Carlos López-Otín and Dra. Ana Gutiérrez-Fernández. (University of Oviedo, Spain). Cells were routinely maintained in Dulbecco's Modified Eagle's medium (DMEM) containing 10 % fetal bovine serum, 50 μg/mL streptomycin and 100 U/mL penicillin (Life Technologies). For transfection experiments, vector containing the human full-length cDNA for fibulin-5 was kindly provided by Dr William P. Schiemann (Case Western Reserve University, Cleveland, USA). RNA interference kit for knocking down Fbln5 gene was purchased from Origene. Vectors were transfected into cells at 75% confluence using Lipofectamine reagent (Life Technologies) as recommended by the manufacturer. Cells transfected with an empty vector (control) or stably expressing FBLN5 (Fibulin5-WT) were selected with 500 μg/mL G418 (Sigma-Aldrich); and cells with interfered FBLN5 gene (Fibulin-5KD cells) with 0.5 µg/mL puromycin.
Mutagenesis
The QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) was employed to introduce the change RGD to RGE (RGD-RGE) within the Fbln5 sequence, following the manufacturer´s instructions. Primers designed for mutagenesis were: FBLN5MUT-Fw 5′-GCCTGCCGAGGAGAGATGATGTGTGTTAAC-3′ and FBLN5MUT-Rv 5′- GTTAACACACATCATCTCTCCTCGGCAGGC -3′, Vector containing the full-length cDNA for FBLN5 was employed as template. PCR conditions were as follows: 95 °C, 1 min (1 cycle); 95 °C, 50 s, 66°, 50 s and 68° 12 min (18 cycles); and 68 °C, 7 min (1 cycle). PCR products were visualized in a 1.0% agarose gel and DNA sequence was verified before experimental use. Breast cancer cells expressing mutant FBLN5 (Fibulin5-RGE) were selected with 500 μg/mL G418 (Sigma-Aldrich) as described above.
Western-blot and immunocytochemical analysis
Cell extracts were resolved by 8 or 10 polyacrylamide gel electrophoresis, transferred to a PVDF membrane (Millipore) and subsequently probed with the indicated antibodies. The primary antibodies were anti-fibulin-5 antibody from Origene or Santa Cruz Biotechnology; anti-β-actin and anti-α-SMA antibodies from Sigma-Aldrich; anti-Ki-67, anti-E-cadherin, anti-N-cadherin and anti-vimentin from Santa Cruz Biotechnology. Immunoreactive proteins were visualized using HRP-peroxidase labeled anti-rabbit or anti-mouse secondary antibody and the ECL detection system (Pierce). For immunocytochemical analysis, 4T1 cells were fixed with 4% paraformaldehyde and then were blocked with 10% fetal bovine serum. To detect Ki-67, fixed cells were incubated overnight with the H-300 antibody from Santa Cruz Biotechnologies, followed by 1 h incubation with a secondary Alexa 546-conjugated antibody (Life Technologies). DAPI was added at 100 ng/mL to visualize DNA in cell nucleus. Images were obtained using a fluorescence microscope (Axiovert).
Cell proliferation assay
Cell proliferation was measured using the CellTiter 96 Non-radiactive Cell Proliferation Assay kit (Promega). MBA-MB-231 and 4T1 cells (5×103/well) were seeded in 96-well plates and six replicates were performed per condition. Cell proliferation rates were determined on four (4T1) or five (MDA-MB-231) consecutive days using an automated microtiter plate reader Power Wave WS (BioTek). Additionally, cell proliferation was also estimated as an average of Ki-67-positive nuclei in relation to the total number of nuclei per microscopic field as previously reported [19]. To this end, 5×103 stably transfected cells were plated in µ-Dish 35 mm from Ibidi.
The adhesion capacity of the breast cancer lines 4T1 and MDA-MB-231 was analysed using 24-cell culture plates (VWR) coated with fibronectin, laminin, type IV collagen (Sigma-Aldrich) and αvβ3 and α5β1 integrins (R&D Systems). Uncoated wells were employed as a control. For all conditions 3×105 cells/mL were employed, with the exception of MDA-MB -231 in the wells coated with integrin αvβ3 which were used at 1x104 cells/mL. Cells were seeded and allowed to adhere at 37 ºC and 5% CO2 for 30 min. Then, non-adhered cells were removed by washing three times with PBS and remaining cells were fixed with 4% paraformaldehyde and stained with cell stain solution. All data are the mean of three independent experiments.
Results
Fibulin-5RGE induces morphological changes in the 4T1 murine breast cancer cell line
Murine cell line 4T1 is an experimental model for mammary human cancer [21]. To examine the influence of the fibulin-5 RGD motif in the behavior of 4T1 cells, we carried out site-directed mutagenesis to introduce the Asp to Glu change (RGD-to-RGE) at position 56 of the amino acid sequence of the human fibulin-5 (Fig. 1A). Following transfection, we selected clones containing the RGD-to-RGE change (4T1 Fibulin-5RGE cells). As a control, we used same cell line that exogenously expressed wild-type fibulin-5 (4T1 Fibulin-5WT cells). In addition, we carried out RNA interference on FBLN5 gene (4T1 Fibulin-5KD cells) for comparative purposes. Expression level of fibulin-5, Fibulin-5RGE and fibulin-5KD in selected clones was analyzed by Western-blot. 4T1 cells transfected with an empty vector were employed as control (Fig. 1B). Cell morphology was further examined with the finding that both 4T1 Fibulin-5RGE and 4T1 Fibulin-5KD cells shifted the epithelial-like phenotype of this cell line towards a mesenchymal-like phenotype (Fig. 1C). However, 4T1 Fibulin-5WT cells did not undergo any apparent morphological alteration. To investigate the mechanisms underlying those morphological changes, we explored the expression levels of E-cadherin, N-cadherin and vimentin. Both 4T1 Fibulin-5RGE and 4T1 Fibulin-5KD cells showed a drastic decrease in E-cadherin expression with respect to control cells (Fig. 1D). By contrast, expression levels of N-cadherin and vimentin were increased in Fibulin-5RGE and 4T1 Fibulin-5KD cells, but decreased in Fibulin-5WT cells. Overall, these data are compatible with an alteration of the epithetial-to-mesenchymal transtition (EMT) process due to the RGD-to-RGE change in fibulin-5 when expressed in 4T1 cells.
Fibulin-5RGE increases proliferation of 4T1 cells
We have previously shown that presence of exogenous fibulin-5 reduces proliferation of human breast cancer cells which do not express endogenous fibulin-5 [19]. Now, we wanted to evaluate whether the proliferation of the murine 4T1 cell line, which endogenously expresses fibulin-5, can be affected by the exogenous expression of fibulin-5 or fibulin5-RGE. To this end we performed two different approaches. First we examined expression of the nuclear marker Ki-67 (Fig. 2A). Number of Ki-67 positive nuclei does not differ substantially between control (an average of 27% of cells showed Ki-67-positive nuclei staining) and 4T1 Fibulin-5WT cells (23%). However, 4T1 Fibulin-5RGE cells showed considerable increased in the number of Ki-67 positive nuclei (78%) respecting control and 4T1 Fibulin-5WT cells. Interestingly, 4T1 Fibulin-5KD cells also increased number of positive Ki-67 nuclei (65%). Differences in Ki-67 expression could be also appreciated by Western-blot (Fig. 2A). Second approach consisted of a MTT assay (Fig. 2B). Again 4T1 Fibulin-5RGE and 4T1 Fibulin-5KD cells showed an increased level of proliferation respect to control and 4T1 Fibulin-5WT cells. These results illustrate the influence of an intact fibulin-5 to control breast cancer cell proliferation.
Fibulin-5RGE increases the capacity of 4T1 cells to form mammospheres
4T1 cells shows a strong capacity to form mammopheres [22]. To examine whether the exogenous expression of Fibulin-5RGE could affect this capacity, mammosphere-forming units (MFU) were counted for the different conditions assayed. As can be seen in Fig. 3, 4T1 Fibulin-5RGE cells showed the highest capacity to form mammospheres in two consecutive passages. Thus, in the first passage 4T1 Fibulin-5RGE cells showed a 3.2-fold increase in their ability to form mammospheres with respect to control cells; and 2-fold increase in the second passage. This ability is also increased in 4T1 Fibulin-5KD cells, but only in the first passage (2-fold increase). We also noticed that size of mammospheres did not show significant changes among the conditions assayed. However, sharp morphological changes can be observed in mammospheres derived from 4T1 Fibulin-5RGE cells and 4T1 Fibulin-5KD cells (Fig. 3). These changes can be related with the decrease in N-cadherin expression [23], and it could indicate that the anchorage-independent growth may be facilitated in breast cancer cells harboring the RGD-to-RGE change in fibulin-5.
Influence of the RGD-to-RGE change in fibulin-5 in the adhesion and invasion properties of 4T1 cells
To explore whether the RGD-to-RGE change in fibulin-5 may alter adhesion properties of 4T1 cells, we analyzed the capacity of the cells to bind to the ECM components fibronectin, laminin and type IV collagen. Results indicated that 4T1 Fibulin-5WT cells showed the highest capacity to bind to culture plates coated with these ECM components but also the binding to standard culture plates (Fig. 4A). In fact, above 180 cells per field were counted in the cases of binding of 4T1 Fibulin-5WT cells to fibronectin and type IV collagen, and it is noteworthy that in the case of fibronectin the number of attached cells was closed to 250 per field. On the contrary, number of attached 4T1 Fibulin-5KD and 4T1 Fibulin-5RGE cells was between 50 and 75 cells per field in all conditions assayed, including standard culture plates.
We also wanted to know the capacity of 4T1 cells to bind to culture plates coated with αvβ3 and α5β1 integrins (Fig. 4B). Again 4T1 Fibulin-5WT cells showed the highest capacity of attachment to both integrins (58 in the case of αvβ3 and and 48 in the case of α5β1 cells per field respectively), followed by control cells (42 and 36 cells per field). By contrast, neither 4T1 Fibulin-5KD (11 and 19 cells per field) nor 4T1 Fibulin-5RGE (14 and 22 cells per field) cells showed a strong capacity to bind to the integrins αvβ3 or α5β1.
To examine the influence of the RGD-to-RGE change in fibulin-5 on the invasive capacity of 4T1 cells, we employed transwell inserts coated with Matrigel (Fig. 4C). Both 4T1 Fibulin-5KD cells (99 cells per field) and 4T1 Fibulin-5RGE cells (79 cells per field) showed an increase in their invasive properties as compared to 4T1 control cells (52 cells per field). In this assay, 4T1 Fibulin-5WT cells showed the lowest capacity to invade (28 cells per field). These data strongly suggest the influence of fibulin-5 in both cell attachment and cell invasion processes.
RGD-to-RGE change in fibulin-5 potentiates capacity of 4T1 cell to form tumors
The effect of the RGD-to-RGE change in fibulin-5 was examined in vivo through the subcutaneous injection of 4T1 Fibulin-5RGE cells in the flank of five male BALB/c mice. 4T1 Fibulin-5, 4T1 Fibulin-5KD cells were employed for comparative analysis. Five mice were injected with 4T1 cells transfected with an empty vector as control purposes. Volumes of subcutaneous tumors formed were measured for six weeks (Fig. 5A). Tumors derived from 4T1 Fibulin-5KD cells, but especially from 4T1 Fibulin-5RGE cells, showed a considerable larger volumes than those derived for control cells and tumors were macroscopically visible at three weeks. These results reinforce the tumor-protective effect of fibulin-5, but also highlight the involvement of its RGD domain to induce these effects. In addition, we have also verified levels of fibulin-5 expression in tumors derived from Fibulin-5KD 4T1, Fibulin-5RGE and control 4T1 cells (Fig. 5B).
RGD-to-RGE change in fibulin-5 alters behavior of MDA-MB-231 cells
Next, we wanted to know whether the results described above could be reproduced in a breast cancer cell which does not express fibulin-5 endogenously. To this end we employed the MDA-MB-231 cell line due to the expression level of fibulin-5 is undetectable by Western-blot [19]. Following selection of cells expressing fibulin-5RGE (MDA-MB-231 Fibulin-5RGE) and wild-type fibulin-5 (MDA-MB-231 Fibulin-5WT) (Fig. 6A), we first examined the expression of the EMT markers E-cadherin, N-cadherin and vimentin. Main findings consisted of an increase of E-cadherin expression level but a decrease of N-cadherin and vimentin expression levels in MDA-MB-231 Fibulin-5WT cells with respect to both MDA-MB-231 Fibulin-5RGE cells and MDA-MB-231 control cells. Then, we evaluated the ability of the MDA-MB-231 to adhere to the ECM components fibronectin, laminin and type IV collagen. Results revealed that MDA-MB-231 Fibulin-5WT cells showed a high capacity to bind to fibronectin (144 cells per field), laminin (114 cells per field) and type IV collagen (113 cells per field), as compared with Fibulin-5RGE cells (15 to laminin and 19 to type IV collagen cells per field respectively) and control cells (23 to laminin and 15 to type IV collagen, Fig. 6B). In addition, we also examined the binding of those cells to wells coated with αvβ3 integrin. MDA-MB-231 Fibulin-5WT also increased their capacity of binding to this integrin (18 cells per field) as compared to both control (~3 cells per field) and MDA-MB-231 Fibulin-5RGE cells (~4 cells per field, Fig. 6C). Other results supporting the effect of the RGD-to-RGE change in MDA-MB-231 cells are indicated in Supplementary Fig. 1 and Supplementary Fig. 2 (for all supplemental material see www.cellphysiolbiochem.com). Thus, we performed an invasion assay to examine whether the differences in binding could influence invasive capacity of this cell line. Invasion ability of MDA-MB-231 cells was considerable reduced when expressing exogenous fibulin-5 (MDA-MB-231 Fibulin-5WT, 60 cells per field, Supplementary Fig. 1), as compared to invasion capacities of control (140 cells per field) and MDA-MB-231 Fibulin-5RGE cells (188 cells per field). We also wanted to examine if Fibulin-5RGE induces similar effects on MDA-MB-231 cells proliferation than those described above for 4T1 cells. A MTT analysis revealed that fibulin-5 does not alter capacity of MDA-MD-231 cells to proliferate, contrary to what was observed for MDA-MB-231 Fibulin-5WT cells (Supplementary Fig. 2). Taken together, these results strongly suggest that changes in the RGD motif of fibulin-5 may induce changes in breast cancer cells that ultimately lead to increase their protumor properties.
Discussion
Fibulin-5 is a structurally complex extracellular protein. Within its N-terminal region, six calcium-binding epithelial growth factor-like (cbEGF-like) domains can be identified and, in turn, a RGD motif is located in the first cbEGF-like domain [7]. It has been largely proven the function of the RGD motif in cell adhesion as well as its potential application in tumor therapy [24]. In the case of fibulin-5, it is known that its RGD motif mediates cell binding through the interaction with different integrins including αvβ3, αvβ5, α5β1 or α4β1 [9, 25]. For instance, fibulin-5 RGD motif can influence the attachment and spreading of primary aortic smooth muscle cells through β1 integrins. However, the interaction between fibulin-5 RGD motif and β1 integrins failed to activate integrin-mediated signaling pathways, suggesting that fibulin-5 may act as a blocking factor [25].
In a tumor context, it has been shown that loss of interaction between fibulin-5 and β1 integrins hinders tumor growth by increasing the level of reactive oxygen species, affecting the angiogenesis process [20]. However, different reports have highlighted the tumor suppressor functions of fibulin-5 in bladder or lung cancers [5, 12, 13]. We have also previously shown that the exogenous expression of fibulin-5 also confers antitumor properties to breast cancer cell lines [19]. In this work we wanted to explore whether the RGD motif could affect the antitumor role of fibulin-5 in breast cancer cells. To this end we exogenously expressed fibulin-5 containing the RGD-to-RGE change in the murine 4T1 and the human MDA-MB-231 breast cancer cell lines. Different cell-based assays have revealed that the RGD-to-RGE change drastically abolishes the antitumor effect that an intact fibulin-5 displays, and similar results were obtained when we performed knock-down of the FBLN5 gene. Overall these data suggest that the RGD-to-RGE change induce effects comparable to those derived from a loss of function of the FBLN5 gene. In line with these results, a previous report has shown that fibulin-5 promotes adhesion to fibronectin and reduces invasion of hepatocellular carcinoma cells by an integrin-dependent mechanism [26]. However, these effects were not observed when the RGD motif of fibulin-5 was changed to RGE [26]. We also wanted to examine whether the RGD motif of fibulin-5 affects the binging of 4T1 and MDA-MB-231 breast cancer cells to different ECM components as well as the αvβ3 integrin. Results obtained with MDA-MB-231 cells, which endogenous expression of fibulin-5 is absent or scarcely detected [19], revealed that an intact RGD motif increases the binding of MDA-MB-231 cells particularly to the basal lamina components laminin and type IV collagen, as well as to the αvβ3 integrin. In stark contrast, the RGD-to-RGE change drastically reduces this binding. Previous reports have involved αvβ3 integrin in breast cancer. Thus, αvβ3 integrin increases metastasis of breast cancer cells to bone [27], therefore it could be a therapeutic target for prevention of skeletal metastasis [28]. Moreover, MDA-MB-231 cells expressing fibulin-5 harboring the RGD-to-RGE change do not reduce their ability to invade. Thus, it could be speculated that the RGD motif is a key structural element to promote the antitumor effects of fibulin-5, which could be increased by blocking the signaling pathways mediated by the activation of integrins that could interact with fibulin-5. These findings would reinforce the antitumor effects that intact fibulin-5 can display within the tumor microenvironment.
Conclusion
Our results provide new evidence about the relevance of fibulin-5 in proliferation, invasion and the induction of EMT process in 4T1breast cancer cells. Induction of cell proliferation and EMT have been also described due to different factors in other commonly employed breast cancer cell lines [29, 30]. Our data also highlight the context-specific effects associated to fibulin-5 [11, 31]. These findings should help to decipher some of the molecular mechanisms underlying the tumor-protecting functions elicited by fibulin-5. Also, our findings deepen on the tumor-protective functions that an intact fibulin-5 induces in the tumor microenvironment, which could contribute the development of future therapies for breast cancer treatment.
Acknowledgements
This work was supported by the Instituto Asturiano de Odontología (IAO). Yamina Mohamedi is recipient of a fellowship from the FICYT, Fundación para el Fomento en Asturias de la Investigación Científica Aplicada y la Tecnología ("Severo Ochoa" Research Program, Principado de Asturias), and Tania Fontanil is recipient of a contract from the IAO. Mice were housed under specific pathogen-free conditions and following the guidelines of the Committee on Animal Experimentation of the Universidad de Oviedo, Asturias, Spain.
Disclosure Statement
The authors declare no conflicts of interest.
References
|
1 Bonnans C, Chou J, Werb
Z: Remodelling the extracellular matrix in development and disease. Nat Rev
Mol Cell Biol 2014;15:786-801. |
|
|
|
|
|
2 Rozario T, DeSimone DW:
The extracellular matrix in development and morphogenesis: a dynamic view.
Dev Biol 2010;341:126-140. |
|
|
|
|
|
3 Lu P, Weaver VM, Werb
Z: The extracellular matrix: a dynamic niche in cancer progression. J Cell
Biol 2012;196:395-406. |
|
|
|
|
|
4 Gallagher WM, Currid
CA, Whelan LC: Fibulins and cancer: friend or foe? Trends Mol Med
2005;11:336-340. |
|
|
|
|
|
5 Obaya AJ, Rua S,
Moncada-Pazos A, Cal S: The dual role of fibulins in tumorigenesis. Cancer
Lett 2012;325:132-138. |
|
|
|
|
|
6 de Vega S, Iwamoto T,
Yamada Y: Fibulins: multiple roles in matrix structures and tissue functions.
Cell
Mol Life Sci 2009;66:1890-1902. |
|
|
|
|
|
7 Yanagisawa H,
Schluterman MK, Brekken RA: Fibulin-5, an integrin-binding matricellular
protein: its function in development and disease. J Cell Commun Signal 2009;3:337-347. |
|
|
|
|
|
8 Papke CL, Yanagisawa H:
Fibulin-4 and fibulin-5 in elastogenesis and beyond: Insights from mouse and
human studies. Matrix Biol 2014;37:142-149. |
|
|
|
|
|
9 Nakamura T, Lozano PR,
Ikeda Y, Iwanaga Y, Hinek A, Minamisawa S, Cheng CF, Kobuke K, Dalton N,
Takada Y, Tashiro K, Ross Jr J, Honjo T, Chien KR: Fibulin-5/DANCE is
essential for elastogenesis in vivo. Nature 2002;415:171-175. |
|
|
|
|
|
10 Yanagisawa H, Davis
EC, Starcher BC, Ouchi T, Yanagisawa M, Richardson JA, Olson EN: Fibulin-5 is
an elastin-binding protein essential for elastic fibre development in vivo. Nature
2002;415:168-171. |
|
|
|
|
|
11 Schiemann WP, Blobe
GC, Kalume DE, Pandey A, Lodish HF: Context-specific effects of fibulin-5
(DANCE/EVEC) on cell proliferation, motility, and invasion. Fibulin-5 is
induced by transforming growth factor-beta and affects protein kinase
cascades. J
Biol Chem 2002;277:27367-27377. |
|
|
|
|
|
12 Hu Z, Ai Q, Xu H, Ma
X, Li HZ, Shi TP, Wang C, Gong DJ, Zhang X: Fibulin-5 is down-regulated in
urothelial carcinoma of bladder and inhibits growth and invasion of human
bladder cancer cell line 5637. Urol Oncol 2011;29:430-435. |
|
|
|
|
|
13 Yue W, Sun Q,
Landreneau R, Wu C, Siegfried JM, Yu J, Zhang L: Fibulin-5 suppresses lung
cancer invasion by inhibiting matrix metalloproteinase-7 expression. Cancer Res
2009;69:6339-6346. |
|
|
|
|
|
14 Chen X, Song X, Yue W,
Chen D, Yu J, Yao Z, Zhang L: Fibulin-5 inhibits Wnt/beta-catenin signaling
in lung cancer. Oncotarget 2015;6:15022-15034. |
|
|
|
|
|
15 Ohara H, Akatsuka S,
Nagai H, Liu YT, Jiang L, Okazaki Y, Yamashita Y, Nakamura T, Toyokuni S:
Stage-specific roles of fibulin-5 during oxidative stress-induced renal
carcinogenesis in rats. Free Radic Res 2011;45:211-220. |
|
|
|
|
|
16 Hwang CF, Shiu LY, Su
LJ, Yin YF, Wang WS, Huang SC, Chiu TJ, Huang CC, Zhen YY, Tsai HT, Fang FM,
Huang TL, Chen CH: Oncogenic fibulin-5 promotes nasopharyngeal carcinoma cell
metastasis through the FLJ10540/AKT pathway and correlates with poor
prognosis. PLoS One 2013;8:e84218. |
|
|
|
|
|
17 Lee YH, Albig AR,
Regner M, Schiemann BJ, Schiemann WP: Fibulin-5 initiates
epithelial-mesenchymal transition (EMT) and enhances EMT induced by TGF-beta
in mammary epithelial cells via a MMP-dependent mechanism. Carcinogenesis
2008;29:2243-2251. |
|
|
|
|
|
18 Xiao W, Zhou S, Xu H,
Li H, He G, Liu Y, Qi Y: Nogo-B promotes the epithelial-mesenchymal
transition in HeLa cervical cancer cells via Fibulin-5. Oncol Rep
2013;29:109-116. |
|
|
|
|
|
19 Mohamedi Y, Fontanil
T, Solares L, Garcia-Suarez O, Garcia-Piqueras J, Vega JA, Cal S, Obaya AJ:
Fibulin-5 downregulates Ki-67 and inhibits proliferation and invasion of
breast cancer cells. Int J Oncol 2016;48:1447-1456. |
|
|
|
|
|
20 Schluterman MK,
Chapman SL, Korpanty G, Ozumi K, Fukai T, Yanagisawa H, Brekken RA: Loss of
fibulin-5 binding to beta1 integrins inhibits tumor growth by increasing the
level of ROS. Dis Model Mech 2010;3:333-342. |
|
|
|
|
|
21 Pulaski BA,
Ostrand-Rosenberg S: Mouse 4T1 breast tumor model. Curr Protoc Immunol 2001;
DOI:10.1002/0471142735.im2002s39. |
|
|
|
|
|
22 Wei L, Liu TT, Wang
HH, Hong HM, Yu AL, Feng HP, Chang WW: Hsp27 participates in the maintenance
of breast cancer stem cells through regulation of epithelial-mesenchymal
transition and nuclear factor-kappaB. Breast Cancer Res 2011;13:R101. |
|
|
|
|
|
23 Manuel Iglesias J,
Beloqui I, Garcia-Garcia F, Leis O, Vazquez-Martin A, Eguiara A, Cufi S,
Pavon A, Menendez JA, Dopazo J, Martin AG: Mammosphere formation in breast
carcinoma cell lines depends upon expression of E-cadherin. PloS One
2013;8:e77281. |
|
|
|
|
|
24 Wang F, Li Y, Shen Y,
Wang A, Wang S, Xie T: The functions and applications of RGD in tumor therapy
and tissue engineering. Int J Mol Sci 2013;14:13447-13462. |
|
|
|
|
|
25 Lomas AC, Mellody KT,
Freeman LJ, Bax DV, Shuttleworth CA, Kielty CM: Fibulin-5 binds human
smooth-muscle cells through alpha5beta1 and alpha4beta1 integrins, but does
not support receptor activation. Biochem J 2007;405:417-428. |
|
|
|
|
|
26 Tang JC, Liu JH, Liu
XL, Liang X, Cai XJ: Effect of fibulin-5 on adhesion, migration and invasion
of hepatocellular carcinoma cells via an integrin-dependent mechanism. World
J Gastroenterol 2015;21:11127-11140. |
|
|
|
|
|
27 Sloan EK, Pouliot N,
Stanley KL, Chia J, Moseley JM, Hards DK, Anderson RL: Tumor-specific
expression of alphavbeta3 integrin promotes spontaneous metastasis of breast
cancer to bone. Breast Cancer Res 2006;8:R20. |
|
|
|
|
|
28 Zhao Y, Bachelier R,
Treilleux I, Pujuguet P, Peyruchaud O, Baron R, Clement-Lacroix P, Clezardin
P: Tumor alphavbeta3 integrin is a therapeutic target for breast cancer bone
metastases. Cancer Res 2007;67:5821-5830. |
|
|
|
|
|
29 Pei YF, Lei Y, Liu XQ:
miR-29a promotes cell proliferation and EMT in breast cancer by targeting ten
eleven translocation 1. Biochim Biophys Acta 2016;1862:2177-2185. |
|
|
|
|
|
30 Jiang G, Shi W, Fang
H, Zhang X: miR27a promotes human breast cancer cell migration by inducing
EMT in a FBXW7dependent manner. Mol Med Rep 2018;18:5417-5426. |
|
|
|
|
|
31 Albig AR, Schiemann
WP: Fibulin-5 function during tumorigenesis. Future Oncol 2005;1:23-35. |
|