Down-Regulation of CK2α Leads to Up-Regulation of the Cyclin-Dependent Kinase Inhibitor p27KIP1 in Conditions Unfavorable for the Growth of Myoblast Cells
Barbara Guerraa Maja Dembica Mohammad A. Siddiquia Isabel Dominguezb Paolo Ceppia Brage S. Andresena
aDepartment of Biochemistry and Molecular Biology, University of Southern Denmark, Odense, Denmark, bDepartment of Medicine, Boston University School of Medicine, Boston, MA, USA
Key Words
Ck2α • Cell cycle progression • p27KIP1 • Dyrk1B • AMPK
Abstract
Background/Aims: Compelling evidence indicates that CK2α, which is one of the two catalytic isoforms of protein kinase CK2, is required for cell viability and plays an important role in cell proliferation and differentiation. While much is known on CK2 in the context of disease states, particularly cancer, its critical role in non-cancerous cell growth has not been extensively investigated. Methods: In the present study, we have employed a cell line derived from rat heart with inducible down-regulation of CK2α and CK2α-knockout mouse tissue to identify CK2-mediated molecular mechanisms regulating cell growth. For this, we have performed Incucyte® live-cell analysis and applied flow cytometry, western blot, immunoprecipitation, immunohistochemistry, RT-qPCR and luciferase-based methods. Results: Here, we show that lack of CK2α results in significantly delayed cell cycle progression through G1, inhibition of cyclin E-CDK2 complex, decreased phosphorylation of Rb protein at S795, and inactivation of E2F transcription factor. These events are accompanied by nuclear accumulation and up-regulation of the cyclin-dependent kinase inhibitor p27KIP1 in cells and CK2α-knockout mouse tissues. We found that increased levels of p27KIP1 are mainly attributable to post-translational modifications, namely phosphorylation at S10 and T197 amino acid residues catalyzed by Dyrk1B and AMPK, respectively, as silencing of FoxO3A transcription factor, which activates CDKN1B the gene coding for p27KIP1, does not result in markedly decreased expression levels of the corresponding protein. Interestingly, simultaneous silencing of CK2α and p27KIP1 significantly impairs cell cycle progression without increasing cell death. Conclusion: Taken together, our study sheds light on the molecular mechanisms controlling cell cycle progression through G1 phase when myoblasts proliferation potential is impaired by CK2α depletion. Our results suggest that elevated levels of p27KIP1, which follows CK2α depletion, contribute to delay the G1-to-S phase transition. Effects seen when p27KIP1 is down-regulated are independent of CK2α and reflect the protective role exerted by p27KIP1 under unfavorable cell growth conditions.
Introduction
Cell cycle progression is tightly controlled by the cyclin-dependent kinases (CDKs). These enzymes are regulated at a post-translational level and by their association to specific activating cyclins, and inactivating cyclin-dependent kinase inhibitors (CKIs) [1]. In mammalians, the decision to pass through the “restriction point” in late G1 coincides with the D cyclins pairing with CDK4 or -6 while the interaction between cyclin E and CDK2 is active at the G1/S boundary, and the complex between cyclin A and CDK2 modulates cell cycle transition through the S phase [2]. p27KIP1 belongs to the CIP/KIP (CDK interacting protein kinase inhibitory protein) family of CKIs and it regulates the G1-S cell cycle transition by specifically inhibiting the cyclin E/CDK2 and cyclin A/CDK2 complexes, respectively [3]. The levels and localization of p27KIP1 in cells are controlled by transcriptional mechanisms, post-translational modifications and signaling pathways regulating the ubiquitin-proteasome system [4, 5]. Although one of the major functions of p27KIP1 is the inhibition of the G1 cyclin/CDK complexes in response to unfavorable conditions (e.g. lack of mitogenic signals), it is known that this protein may significantly contribute to cell viability while having only a limited effect on the regulation of the cell cycle [6, 7].
Another enzyme that has been linked to the control of various intracellular processes including the regulation of the cell cycle, is protein kinase CK2 (reviewed in [8-11]). CK2 is typically described as a constitutively active heterotetrameric enzyme composed of two catalytic subunits α and/or α’ and two regulatory β-subunits. However, mounting evidence has suggested that these three subunits may be functionally specialized, and exist outside the tetrameric complex as individual isoforms (reviewed in [12]). They can display different subcellular localization, expression levels and have independent interaction partners [12-15]. The notion that the three CK2 isoforms have distinct cellular functions is also supported by experiments based on gene targeting with homologous recombination showing that knock-out of CK2α or CK2β leads to early embryonic lethality while homozygous deletion of CK2α’ in mice results in a viable offspring, though, the males are unfertile and affected by oligozoospermia [16-18].
CK2 has been implicated in every stage of cell cycle progression in eukaryotic cells by forming a complex and/or phosphorylating cell cycle regulatory proteins including PLK1, p53, p21WAF1 as well as p27KIP1 (reviewed in [9, 12, 19]). The role of CK2 in cell survival has been extensively studied in cancer cell lines and solid human tumors where it has been shown that its increased activity and expression correlate with the degree of malignancy of the tumor and resistance towards induction of cell death (reviewed in [11]). In contrast to the large number of studies focusing on the role of CK2 in human diseases, particularly cancer, the function of CK2 in non-cancerous cells has been partially addressed.
We have recently established a myoblast cell line (hereafter referred to as H9c2-CK2α-44) derived from rat heart tissue with the ability to induce down-regulation of CK2α by a doxycycline-inducible shRNA [20]. An important observation that emerged from the study is that lowered expression levels of CK2α resulted in decreased cell proliferation and a significant slightly increased G1 population over the course of several days. However, unlike cancer cells, reduced cell proliferation was not accompanied by increased cell death either in vivo or in vitro [20].
The aim of the present study was to shed light on the underlying molecular mechanisms responsible for the observed cell cycle delay and impaired cell proliferation observed in myoblasts upon depletion of CK2α. Our data show that lack of CK2α resulted in a strong inhibition of CDK2 activity and promoted increased levels of p27KIP1 both in cells and in vivo. Stabilization of p27KIP1 was mainly attributable to post-translational modifications implicating AMPK and Dyrk1B as the kinases responsible, at least in part, for this effect. Subsequent siRNA-mediated experiments aiming at decreasing the expression of p27KIP1 indicated that lack of proliferation potential induced by the silencing of CK2α triggered a p27KIP1-dependent protective mechanism in conditions critical for cell growth.
Materials and Methods
Cell culture and treatments
The cell line H9c2-CK2α-44 was derived from the parental myoblast H9c-2 cell line originated from rat heart (American Type Culture Collection, ATCC, Rockville, MD, USA) and cultivated at 37°C under a 5% CO2 atmosphere in Dulbecco’s modified Eagle medium (DMEM, Invitrogen, Taastrup, Denmark) supplemented with 10% fetal bovine serum (FBS, Biochrom AG, Berlin, Germany). Cells were added 1 μg/ml doxycycline (Sigma-Aldrich, Brøndby, Denmark) as indicated in the figure legends. Cell synchronization at G0/G1 was achieved by incubating cells in the presence of 0.1% fetal bovine serum for 48 hours. The cell cycle was resumed by adding complete growth medium and cells were harvested at various time points as indicated in the figure legends.
Down-regulation of protein expression was carried out by RNA interference as previously described [21]. Sets of four small interfering RNA duplexes (ON-TARGET plus SMART pools, Thermo Scientific, Rockford, IL, USA) directed against the mRNA coding for proteins indicated in the figures were used. Wortmannin, aphidicolin, propidium iodide and rat recombinant IGF-I were purchased from Sigma-Aldrich, Mirk/Dyrk1B inhibitor (Compound A) was obtained from Calbiochem (Darmstadt, Germany) while Dorsomorphine was obtained from Tocris Bioscience (Abingdon, United Kingdom).
IncuCyte S3 image capture and analysis
Cells were seeded in 96-well plates or 6-well plates and imaged within 30 minutes from plating or according to experimental conditions shown in the figures, using phase contrast channel in the IncuCyte S3 platform (Sartorius, Göttingen, Germany). Four sets of phase contrast images from distinct regions within each well were taken at intervals indicated in the figures using a 10X objective. IncuCyte S3 image analysis software was set to detect the edges of the cells and to determine their confluence in percentage. Graphs were generated with the IncuCyte image analysis software graph/export functions and Microsoft Excel software.
Preparation of cell lysate, western blot, antibodies, immunoprecipitation and kinase assays
Harvested cells were further processed for SDS-PAGE and subsequent western blot analysis as described in [22]. Proteins were detected by incubating western blot membranes with the following antibodies: polyclonal anti-CK2α obtained by immunizing rabbits against the human full-length protein sequence; polyclonal anti-CK2α’ obtained by immunizing rabbits with a specific peptide sequence of human CK2α’ (i.e. SQPCADNAVLSSGTAAR); mouse monoclonal anti-CK2b (KinaseDetect Aps, Odense, Denmark); rabbit polyclonal anti-phospho-Rb (S795), rabbit monoclonal anti-cyclin E1, rabbit monoclonal anti-p27KIP1, rabbit polyclonal anti-AKT, rabbit polyclonal anti-phospho-AKT (T308), rabbit polyclonal anti-acetyl CoA carboxylase (ACC), rabbit polyclonal anti-phospho-ACC (S79), rabbit polyclonal anti-AMPKα, rabbit monoclonal anti-FoxO1, rabbit monoclonal anti-FoxO3A, rabbit monoclonal anti-phospho-FoxO3A (S253), rabbit monoclonal anti-MCM4 and rabbit monoclonal anti-MCM7 (all from Cell Signaling Technology, MA, USA); mouse monoclonal anti-Rb, rabbit polyclonal anti-cyclin A, rabbit polyclonal anti-cyclin D1, rabbit polyclonal anti-E2F, goat polyclonal anti-MCM3, goat polyclonal anti-MCM6, mouse monoclonal anti-p21WAF1 and mouse monoclonal anti-FoxO3A (all from Santa Cruz Biotechnology, Heidelberg, Germany); rabbit monoclonal anti-phopho-p27KIP1 (S10, Abcam, Cambridge, United Kingdom); mouse monoclonal anti-β-actin (Sigma-Aldrich); rabbit polyclonal anti-phospho-p27KIP1 (T197) (R&D Systems, Abingdon, UK); rabbit polyclonal anti-phospho-AKT (S129) (Abgent, San Diego, CA, USA).
Whole cell lysate (500 μg) was employed for immunoprecipitation of CDK2 using mouse monoclonal anti-CDK2 antibody (Santa Cruz Biotechnology) essentially as previously described [23]. Immunoprecipitated CDK2 was employed as kinase source in enzyme assay performed for 15 minutes at 30°C in a 25 μl reaction mixture containing kinase buffer (50 mM Tris/HCl pH 7.4, 10 mM MgCl2, 1 mM DTT, 0.1 mM EDTA, 10 mM β-glycerophosphate, 50 μM ATP, 10 μCi [γ-32P] ATP) and 1 μg histone H1 (Sigma-Aldrich). Reactions were stopped by adding SDS-PAGE sample buffer and further processed as previously described [22].
Cell cycle analysis and quantification of cell death
Cells were collected by trypsinization after treatment as indicated in the figure legends, washed with PBS and fixed overnight in 70% ethanol at -20°C. Cell cycle analysis was carried out employing a FACSCalibur flow cytometer (BD Biosciences, Franklin Lake, New Jersey, USA) following staining with 20 μg/ml propidium iodide in the presence of 40 μg/ml RNAse (Sigma-Aldrich). Compensation was applied to eliminate overlap between propidium iodide and GFP emissions due to inducible expression of the protein in the presence of doxycycline. Data acquisition was carried out with Cell Quest Pro Analysis software (BD Biosciences). Determination of the percentage of cells with reduced/fragmented DNA content (i.e. sub-G1 cells) indicates activation of cell death.
Luciferase reporter assay
The transcription activity of E2F-1 was determined by transfecting cells with a luciferase reporter vector (pGL2-AN) carrying the E2F-1 promoter sequence (Addgene plasmid #20950). Control experiments were performed transfecting cells with the empty vector. Transfection of cells was carried out with Lipofectamine 3000 (Invitrogen). After 48 hours from transfection, whole cell extracts were employed for measuring the activity of luciferase applying the Luciferase Reporter Assay System kit according to the manufacturer’s guidelines (Promega, Stockholm, Sweden). Luminescence was measured using a Perkin Elmer Victor Light 1420 luminescence counter at 560 nm. Three independent experiments, each prepared in triplicate, were performed with reproducible results.
Immunostaining
Immunostaining was carried out essentially as described in [24] employing rabbit monoclonal anti-p27KIP1, anti-FoxO3A and anti-FoxO1 antibodies (Cell Signaling Technology), respectively. Incubation with the primary antibodies was followed by incubation with biotinylated swine anti-rabbit immunoglobulin (Dako, Glostrup, Denmark) and subsequently streptavidin-conjugated Alexa Fluor 555 (Thermo Fisher Scientific). Cells were counterstained with 4’,6’-diamidino-2-phenylindole (DAPI, Sigma-Aldrich) and analyzed on a Leica DMRBE microscope equipped with a DFC 420C camera and Leica Application Suite V 3.3.0 software (Leica Microsystem, Wetzler, Germany) at 40x magnification.
Immunological analysis of mouse tissue sections was performed essentially as described in [20]. Detection of p27KIP1 was carried out staining three somite-paired WT and CK2α-/- embryos (KO) with rabbit polyclonal anti-p27KIP1 (Thermo Fisher Scientific). Nuclear staining of the cells was carried out by incubation with DAPI (Invitrogen). As negative controls, to one section of each slide no primary antibody was added, and to another neither primary nor secondary antibodies were added. Photographs were taken with a Nikon Eclipse TE-2000E/Photometrics CoolSnapHQ2 camera with NIS-elements software at the same magnification and exposure time, and analyzed using ImageJ (NIH, USA).
qPCR analysis
Total RNA from cultured cells was isolated using QIAzol Lysis Reagent (Qiagen, Hilden, Germany) and phenol-chloroform extraction. cDNA synthesis was performed using SuperScript® VILO™ cDNA Synthesis Kit (Invitrogen, CA, USA). 2.5 ng of cDNA was used in triplicate for the qPCR reaction with the SYBR-green premix [FastStart Essential DNA Green Master (Roche Diagnostics, CH)]. The qPCR reaction was run on a Roche LightCycler 480. The absolute quantification method was used to determine the concentration of each sample in relation to a standard curve of 7 (5 –fold) serial dilutions of known concentration, made with a cDNA mix of all the samples, and a no-template control. PCR efficiency values (= 10(-1/slope) − 1) were between 1.80 and 2.18, and r2 = 0.96 or higher. The specificity of each amplification was analyzed by melting curve analysis.
The primers (LGC Biosearch Technologies, Risskov, DK), were designed to span exon-exon junctions of the Rattus norvegicus genes and were as follows: CDKN1B (TTCGCAAAACAAAAGGGCCA and AGGAATTATTCTTAATTCGGAGCTG), and HPRT1 (CTTCCTCCTCAGACCGCTTT and CATCACTAATCACGACGCTGG).
Statistical analysis
Where indicated, the results were subjected to statistical analysis employing the Student’s t test. The level of significance is indicated in the figure legends.
Results
Down-regulation of CK2α causes delayed cell cycle progression through G1 and the G1/S border, molecular mechanism dynamics
Earlier work in our laboratory showed that myoblasts with down-regulation of CK2α proliferate more slowly and display an increase in the fraction of cells in G1 as compared to the parental cells [20]. To further investigate this, we used the IncuCyte S3 live-cell imaging system to measure cell proliferation employing a real-time kinetic platform. Results shown in Fig. 1 demonstrated that lack of CK2α induces significant inhibition of cell growth and delayed transition through G1 and/or to S phase. This is consistent with our previous findings [20]. Furthermore, doxycycline did not show any significant effect on the parental cell line (i.e. H9c-2 cells, Supplementary Fig. S1).
To better evaluate the dynamic of S phase entry in cells expressing or depleted of CK2α we measured the cells’ DNA content by flow cytometry following synchronization in G0/G1 induced by serum withdrawal. Synchronized control cells entered the S phase within 10 h after addition of serum, whereas, entry into S phase was delayed to after 12 h in cells depleted of CK2α (Fig. 2A, B). In order to examine the changes in the expression levels of key signaling molecules controlling progression through G1 phase and beyond, we performed western blot analysis of whole lysate from cells with down-regulated CK2α. This showed decreased cyclin D1 levels and delayed expression of cyclin E and cyclin A while the phosphorylation of the retinoblastoma protein (pRb) at S795 was similar at 10 h and appeared reduced at later time points as compared to control cells (Fig. 2C). In line with previous observations ([20] and reviewed in [12]), down-regulation of CK2α was accompanied by lower expression levels of CK2b (Fig. 2C) supporting the notion that the stability of CK2b is dependent on the expression of CK2α and possibly regulated by an intermolecular phosphorylation event (reviewed in [19]).
Because phosphorylation of pRb at S795 is catalyzed by cyclin D/CDK4 and/or CDK2 in complex with cyclin E and cyclin A, respectively [25], we analyzed the kinase activity of CDK2 which plays a critical role in the G1 phase while mostly bound to cyclin E [2]. Whole lysate from cells harvested at different time points was used in immunoprecipitation assays with antibodies directed against CDK2. The kinase activity in immune complexes was determined by in vitro kinase assay using histone H1 as substrate. As shown in Fig. 2D, down-regulation of CK2α resulted in significantly reduced CDK2 kinase activity. Except at 16 h, this was accompanied by a decreased signal derived from the interacting cyclin E. It should be taken into account, though, that the kinase activity of CDK2 is additionally regulated by the associated cyclin A (results not shown) which contributes to the level of phosphorylation of histone H1 and, thus, of pRb at S795 in cells.
Next, we examined the ability of cells to progress to S phase following incubation with aphidicolin, which is a potent inhibitor of DNA polymerase α, δ and ε that reversibly arrests cells at the G1/S boundary ([26] and reviewed in [27]). Control cells arrested at the G1/S border, resumed proliferation and entered S phase within 2 hours after release from the aphidicolin block. In contrast, cells with down-regulated CK2α resumed the cell cycle and entered S phase after approximately 6 hours after the removal of aphidicolin (Fig. 3A, B). Western blot analysis of whole lysates from control cells showed that the levels of cyclin E decreased gradually as the cells entered S phase and this was accompanied by sustained expression of cyclin A. Conversely, in cells lacking CK2α, cyclin E expression was weakly detectable while cyclin A signal started to increase at approximately 6 hours after adding full growth medium coinciding with cells actively entering S phase (Fig. 3C). The measurement of CDK2 activity in whole lysates from control cells treated as outlined in Fig. 3A showed an increase in kinase activity for up to 6 hours after release from the aphidicolin block (Fig. 3D). As we did not detect a concomitant increase in the binding to cyclin E, we suspect that CDK2 activity mainly derived from its association with cyclin A. Conversely, we found that CDK2 activity in whole lysates from cells depleted of CK2α was considerably lower as compared to control experiments. Overall, these results suggest that decreased phosphorylation of pRb at S795 in cells lacking CK2α (Figs. 2C and 3C) could be attributable to reduced CDK2 kinase activity.
Sequential phosphorylation of pRb by cyclin-CDK complexes (i.e. cyclin D-CDK4/6, cyclin E-CDK2, and cyclin A-CDK2) results in the release of the transcription factor E2F from pRb [28]. As E2F is essential for the transcription of genes necessary for entry into S phase (e.g. cyclin E) and for S phase progression (e.g. cyclin A) [29], we further investigated whether lowered expression levels of cyclin E and cyclin A observed in cells lacking CK2α correlated with changes in the transcription activity of E2F and/or its expression levels. To test this, a reporter assay was carried out employing plasmids containing a 3XE2F promoter fused to the luciferase reporter gene (E2F-1-Luc, [30, 31]). Cells were brought to quiescence by serum withdrawal and then stimulated with growth medium essentially as indicated in Fig. 2A. The activity of endogenous E2F was tested at the indicated time intervals (Fig. 4A). The promoter activity was relatively low in quiescent and early G1 control cells but increased approximately threefold as cells approached the S phase in response to serum stimulation. Conversely, the increase in E2F activity was lower in cells lacking CK2α under the same experimental conditions. The expression of endogenous E2F was verified by immunoblot and results showed that the levels in control cells were similar to those in doxycycline-treated cells (Fig. 4B). As an independent measure of E2F activity, we analyzed expression of minichromosome maintenance (MCM) proteins that are known E2F gene targets. The MCM complex consists of six closely related proteins (MCM2-7) required for the initiation of S phase by coordinating initiation of DNA replication, when associated to chromatin, as DNA unwinding enzymes [32]. Transcription of the MCM genes is up-regulated in G1 phase by E2F [33-35]. We previously showed that the transcripts coding for MCM proteins were among the most significantly down-regulated in cells depleted of CK2α [20]. Thus, since MCM genes are transcriptional targets of E2F, we also examined the expression levels of the corresponding proteins following stimulation of quiescence cells with growth medium (Fig. 4C). The analysis of the time course experiment showed that serum stimulation induced an increase in the expression of the MCM proteins as cells entered S phase and it was more pronounced in the control cells than in cells with lowered expression of CK2α. Interestingly, MCM4 and MCM6 were expressed in quiescent cells and their total expression levels only marginally increased after serum stimulation. Similarly, Arata et al. [36] analyzed the expression of MCM4 and MCM7 using a different cell line and demonstrated the persistent abundance of these helicases along the cell cycle, although their association with chromatin was significantly low in quiescent cells.
Overall, these data suggest that the lack of activation of E2F is responsible, at least in part, for the delayed cell cycle progression in cells with reduced levels of CK2α possibly by affecting the expression of genes coding for proteins (e.g. cyclin E and cyclin A) that play an essential role in S phase entry and progression.
Down-regulation of CK2α results in up-regulation of p27KIP1 in myoblasts and in vivo
The activity of CDK2 is regulated positively and negatively by post-translational modifications and negatively by the association to proteins of the CIP/KIP family (reviewed in [37]). Evidence suggests that p21WAF1 and p27KIP1 may induce similar effects, however, numerous observations indicate that these CKIs are not biologically equivalent as they have non-overlapping functions and different patterns of expression [38]. In resting cells and early G1 phase, p27KIP1 exerts a more prominent role while p21WAF1 levels are low and increase during G1 phase progression in response to mitogenic signals [39]. In fibroblasts, the expression of p27KIP1 is elevated in G0 and G1 and associated to the cyclin E-CDK2 complex while it is rapidly degraded when cells enter S phase [40, 41]. Given the significant inhibition of CDK2 activity observed in cells lacking CK2α, we analyzed the expression of p27KIP1 in cultured cells synchronized by serum starvation (Fig. 5A). We examined the expression of p27KIP1 transcripts from cells treated as shown in Fig. 5A by quantitative PCR. The analysis revealed a significantly higher p27KIP1 mRNA levels in quiescent cells with low expression of CK2α as compared to control cells. However, no further differences were observed between cells expressing or lacking CK2α (Fig. 5B). Next, immunoblot analysis revealed that the levels of p27KIP1 in quiescent cells lacking CK2α were higher than in control cells and the protein appeared to be present for a longer period of time after serum stimulation (Fig. 5C). In contrast, appreciable differences in the amounts of p21WAF1 between control and doxycycline-treated cells were not detected during the entire time-course period.
Distinct post-translational modifications regulate the stability of p27KIP1 during G0/G1 to S phase [41]. Specifically, phosphorylation of p27KIP1 at S10 correlates with increased stability of the protein and its nuclear accumulation in quiescent cells [41-44]. Phosphorylation of p27KIP1 at T197 (T198 in humans) also appears to stabilize the protein in G0 cells (reviewed in [41, 44]). Thus, we examined the levels of phosphorylation of p27KIP1 at S10 and T197, respectively, by using phospho-specific antibodies. Immunoblot analysis revealed significantly higher levels of phosphorylation of p27KIP1 at S10 in quiescent cells depleted of CK2α as compared to control cells. In response to serum stimulation, phosphorylation of p27KIP1 at S10 appeared to decrease more rapidly in control cells (Fig. 5C). In line with findings reported by Sun et al., [45], phosphorylation of p27KIP1 at T197 was not promptly detected in cells arrested in G0, however, the signal raised within 2 hours after release from quiescence and appeared to be stronger in cells lacking CK2α where it remained detectable for up to 6 hours (Fig. 5C). Phosphorylation of p27KIP1 at S10 has been found to regulate this CKI’s stability and subcellular localization [42, 46]. Hence, we analyzed the distribution of p27KIP1 in myoblasts under experimental conditions described in Fig. 5A and in vivo. Cells expressing CK2α displayed a predominant nuclear pool of p27KIP1 and a weak cytoplasmic expression similar to findings reported in mouse embryonic fibroblasts [43] (Fig. 5D and Supplementary Fig. S2A). The localization of p27KIP1 in cell lacking CK2α showed a similar pattern; however, the overall signal was significantly stronger than in control cells supporting the results obtained by western blot analysis (Fig. 5C). Next, immunohistological analysis of p27KIP1 expression was performed in tissues of wild-type (+/+) and CK2α-knockout (-/-) embryos at E10.5 (Fig. 5E, F). This revealed that p27KIP1 was mainly localized in the nuclei and the signal was reproducibly stronger than the background signal detected in the negative control (Supplementary Fig. S2B). Interestingly, significant differences in signal intensity could be detected in wild-type and knockout tissue sections, respectively (Fig. 5F), indicating that loss of CK2α significantly enhances the levels of p27KIP1 in vivo during early mouse development.
The FoxO transcription factors do not affect the expression of p27KIP1 in cells depleted of CK2α
The mammalian FoxO proteins comprise, among others, FoxO1 (FKHR) and FoxO3A (FKHRL1). These are transcription factors mainly expressed in the nucleus to direct the transcription of specific gene targets controlling cell survival, proliferation, metabolism, DNA repair, and differentiation (reviewed in [47, 48]). Overexpression of FoxO proteins induces arrest in G1 phase of the cell cycle attributable to the induction of cell cycle regulatory proteins, including the retinoblastoma-related protein p130 and p27KIP1 (reviewed in [41, 49]). Within this family, FoxO3A is reported to be the major regulator of p27KIP1 expression [50, 51]. To test whether FoxO proteins contribute to the up-regulation of p27KIP1 in cells with down-regulated CK2α, we analyzed the expression of FoxO1 and FoxO3A in cells synchronized by serum withdrawal (Fig. 6A). The expression of endogenous FoxO1 appeared significantly elevated 6 hours after serum stimulation and remained still well detectable 10 hours afterward; however, no significant differences in FoxO1 levels between control and CK2α-depleted cells could be detected (Fig. 6A). Conversely, FoxO3A expression was mainly elevated in quiescent cells and up to 2 hours after serum stimulation and it was slightly higher in cells lacking CK2α than in cells expressing endogenous CK2α. Serum deprivation induces nuclear localization of FoxO proteins to stimulate gene transcription and post-translational modifications regulate their nuclear/cytoplasmic shuttling (reviewed in [52]). Based on these findings, we investigated the cellular localization of FoxO3A by staining the cells with a FoxO3A antibody. Immunofluorescence analysis revealed that FoxO3A was more abundantly localized in the nucleus and marginally in the cytoplasm under both serum starvation and stimulation conditions (Fig. 6B and Supplementary Fig. S2C). Moreover, the intensity of fluorescence signal followed the pattern seen by the western blot analysis (Fig 6A). Analysis of FoxO1 localization indicated that the protein was mainly localized in the nucleus in quiescent cells and in the perinucleus or cytoplasm following serum stimulation. Cells expressing reduced levels of CK2α showed a stronger signal around the nucleus as compared to control cells (Supplementary Fig. S3A, B).
FoxO proteins are negatively regulated by the PI3K/AKT signaling pathway in response to stimulation with cytokines or growth factors [52]. Activated AKT preferentially phosphorylates an amino acid residue located within the nuclear localization signal, which corresponds to S253 in FoxO3A [52]. This event is followed by FoxO3A nuclear export and degradation [49]. To shed light on the role of AKT in the regulation of FoxO3A phosphorylation, serum-starved cells were stimulated by IGF-1 for increasing amounts of time (Fig. 6C). Analysis of the time-course experiment showed detectable levels of phosphorylation of FoxO3A in quiescent cells. Control cells promptly responded to IGF-1 stimulation within 30 minutes and over the entire time course of the experiment. This was accompanied by a concomitant stimulation of AKT kinase activity as indicated by its phosphorylation at the activating T308 and S129 catalyzed by PDK1 and CK2, respectively [53, 54]. Conversely, activation of AKT was significantly lower in cells depleted of CK2α and the phosphorylation status of FoxO3A slightly increased above basal levels approximately between 1 and 2 hours after IGF-1 stimulation. These findings suggest that AKT-mediated phosphorylation at S253 might be crucial for the regulation of FoxO3A function and localization in myoblasts. Finally, synchronized cells treated with scrambled siRNA or siRNA against FoxO3A (Fig. 6D) or FoxO1 (Supplementary Fig. S3B) transcripts did not result in a significant change in the expression levels of p27KIP1 under the indicated experimental conditions although down-regulation of FoxO3A could induce a partial decrease of p27KIP1 mRNA levels (Supplementary Fig. S3C). Overall, these results suggest that the persistently high levels of p27KIP1 in cells depleted of CK2α are mainly a consequence of regulation by post-translational modifications.
Dyrk1B and AMPK contribute to stabilize p27KIP1 in CK2α-depleted cells in quiescent cells and in early G1 phase
Although still a matter of debate, it has been reported that several protein kinases are able to phosphorylate and stabilize p27KIP1 in G0 and early G1 cells. The high expression levels/stability is due to enhanced translation and phosphorylation levels at S10 and T197 ([43, 55, 56] and reviewed in [41, 44]). Known kinases responsible for the modifications of these sites include AKT which targets p27KIP1 at S10 and possibly T197 (reviewed in [44, 57]), Dyrk1B which targets p27KIP1 at S10 ([55] and reviewed in [41, 44]) and AMPK which catalyzes the phosphorylation of p27KIP1 at T197 ([56] and reviewed in [41]). To determine whether these protein kinases contribute to the stability of p27KIP1 in our model system, quiescent cells were stimulated in the presence of full growth medium after pre-treatment with inhibitors specific for the aforementioned protein kinases (Fig. 7A). Incubation of cells with Wortmannin, a potent inhibitor of the phosphatidylinositol 3-kinase (PI3K)/AKT signaling cascade, significantly compromised the kinase activity of AKT as seen by the complete absence of the activating phosphorylation at T308. However, this was not accompanied by changes in the phosphorylation of p27KIP1 at S10 or in the expression levels of endogenous p27KIP1 (Fig. 7B). Conversely, treatment of cells with Compound A, a selective inhibitor of Dyrk1B [58], resulted in partially decreased levels of total p27KIP1 and phosphorylation at S10 confirming previous findings of a role of Dyrk1B kinase in the phosphorylation and stability of p27KIP1 mainly in quiescent cells (Fig. 7C, [44, 55]). Similarly, pre-treatment of cells with Dorsomorphin effectively inhibited AMPK [59], as indicated by decreased phosphorylation of its substrate targets acetyl-CoA carboxylase [P-ACC (S79)] and p27KIP1 [P-p27KIP1 (T197)] and resulted in lower expression levels of endogenous p27KIP1 (Fig. 7D). This is consistent with the notion that AMPK might cooperate with other protein kinases in the stabilization of p27KIP1 in early G1 phase of the cell cycle in myoblasts [56, 60, 61].
Down-regulation of CK2α creates unfavorable conditions for cell proliferation signaled by the up-regulation of p27KIP1
p27KIP1 levels increased when exponentially growing cells ceased proliferation in response to serum withdrawal. However, we showed that in cells depleted of CK2α the expression of p27KIP1 was further up-regulated and remained detectable for a longer period of time upon mitogenic stimulation as compared to control cells. The percentage of cell death was negligible under the indicated culture conditions (Fig. 1B, [20]). We hypothesized that increased levels of p27KIP1 could be responsible for the delayed cell cycle progression observed in cells with silenced CK2α or, alternatively, that p27KIP1 could protect myoblasts from cell death under unfavorable growth conditions triggered by the absence of growth factors and proliferation signal caused by CK2α depletion. This is plausible, as it has been shown that the role of p27KIP1 goes beyond stimulation of cell cycle arrest [6, 62]. To test this, cells were transfected with scrambled siRNA (i.e. Control and Doxycycline-treated cells) or siRNA directed against p27KIP1 transcripts alone or in combination with CK2α silencing (i.e. Combo), synchronized by serum withdrawal and, subsequently, stimulated by adding complete growth medium. As shown in Fig. 8A, silencing of p27KIP1 resulted in significantly increased cell death as compared to control cells. Down-regulation of both CK2α and p27KIP1 (i.e. Combo) resulted in a slightly higher percentage of cell death with respect to p27KIP1-siRNA treated cells which was, however, not significant. These data altogether suggest that increased expression of p27KIP1 following silencing of CK2α does not promote further protection from apoptosis. We noticed, however, a significant difference in cell density when both proteins were simultaneously down-regulated (Fig. 8C and data not shown). Hence, in order to evaluate the role of p27KIP1-knock-down on myoblasts proliferation, we subjected the cells to experimental conditions indicated in Fig. 8B and analyzed proliferation by using the Incucyte S3 live-cell analysis system. As shown in Fig. 8C, down-regulation of p27KIP1 and CK2α, respectively, resulted in markedly slower proliferation rate of the cells as compared to control experiment. Remarkably, combined silencing of both proteins resulted in significantly impaired proliferation of the cells. In support of these results, we additionally carried out experiments similar to those shown in Fig. 8C following siRNA-mediated down-regulation of AMPKα. We anticipated that silencing of AMPKα would lead to decreased proliferation of the cells by destabilizing p27KIP1 expression as seen in cells treated with Dorsomorphin. Data reported in Supplementary Fig. S4 confirmed our prediction and revealed a pattern similar to that shown on Fig. 8C. However, altogether, these results raise the possibility that p27KIP1 exerts a protective role not linked to CK2α in cells lacking proliferation potential.
Discussion
Ample evidence indicates that CK2α plays a crucial role in the regulation of cell cycle progression in cancer cells. However, its importance in non-cancerous cells has been partially addressed. To elucidate the molecular mechanisms by which CK2α regulates cell replication, we investigated the expression and phosphorylation levels of proteins that regulate the G1 to S cell cycle transition. Here, we propose a model explaining how CK2α may contribute to cell cycle progression at G1 phase in myoblasts (Fig. 9). Low expression of p27KIP1, which plays a major role in the control of G0/G1 cell cycle progression, potentiates cyclin E-CDK2 complex activation. G1 to S progression is subsequently promoted by the phosphorylation of Rb allowing activation of E2F transcription factor and the expression of a number of cell cycle-related genes including cyclin E, cyclin A, CDKs and MCM proteins. Down-regulation of CK2α results in accumulation of p27KIP1 and inhibition of CDK2-cyclin E complex causing delayed G1 to S cell cycle transition and reduced cell proliferation.
The expression/stability of p27KIP1 is regulated at multiple levels including post-translational modifications. It has been reported that activation of CK2 attenuates FoxO3A function thereby down-regulating p27KIP1 in human prostate cancer cells [63]. Our data show that CK2α regulates FoxO3A levels in an AKT-dependent manner; however, we found that the expression of p27KIP1 is mainly controlled by post-translational modifications and not by FoxO3A. This supports the notion that p27KIP1 is regulated in a complex manner and its expression might be controlled by different mechanisms depending on the cell type and cellular context.
Although partially understood, it has been reported that at the early stage of the cell cycle Dyrk1B, AKT, and AMPK are responsible for the stability of p27KIP1 through phosphorylation at S10 and T197 [41, 44]. As with S10, T197 is phosphorylated in early G1 [64]. Based on our results, it is unlikely that AKT acted as a major contributor to p27KIP1 stability as its inhibition by Wortmannin did not change the expression levels of p27KIP1. Our data are in line with the findings reported by Larrea et al., which showed that 6 hours of PI3K inhibition did not affect the levels of either AKT, phospho-p27KIP1-S10 or total p27KIP1 in MCF-7 cells [65]. Conversely, inhibition of Dyrk1B and AMPK, respectively, led to partial destabilization of p27KIP1 (Fig. 7) supporting the notion that both protein kinases contribute to the regulation of p27KIP1 expression during G0/G1 phase. The involvement of other kinases cannot be excluded, in fact, in addition to Dyrk1B, ERK2 was reported to phosphorylate p27KIP1 at S10 and AKT, RSK1, RSK2 and PKC have been shown to phosphorylate p27KIP1 at T197 beside AMPK [44, 64]. One additional candidate is KIS a protein kinase which directly interacts with and phosphorylates p27KIP1 at S10 in leukemia cells [66]. However, contrary with previously published data [44] and our own results showing that compromised cell cycle progression correlates with up-regulation of p27KIP1 expression and phosphorylation levels at S10, Nakamura et al. [66] reported that KIS promotes cell cycle progression by binding and phosphorylating p27KIP1 at S10 promoting nuclear export and its inhibition.
Overall, although it remains to be determined whether these protein kinases are all relevant and under which circumstances (e.g. mitogenic signal, stress response, cell cycle phase, nutrients levels), our data demonstrate that phosphorylation of S10 and T197 is an important event ensuring increased stability of p27KIP1 early in G0/G1 phase. At present, it is not clear how CK2α silencing results in increased Dyrk1B-mediated phosphorylation of p27KIP1 at S10. Future studies should address a possible crosstalk between these protein kinases in the regulation of cell cycle progression. Interestingly, data shown in Fig. 7C indicate that silencing of CK2α results in increased AMPK-mediated phosphorylation of p27KIP1 at T197 suggesting a direct or indirect control of AMPK activity by CK2α. This is in line with work by Dixit et al., demonstrating that inhibition of CK2 by small molecule inhibitors induces metabolic adaptation and survival in glioma cells by activating the PDK4-AMPK axis [67].
Although speculative at the moment, it is likely that the effects exerted by p27KIP1 might be largely cell-type dependent. The importance of p27KIP1 expression in the early stages of cell cycle transition is well documented. However, the outcome of different post-translational modifications remains to be further elucidated in view of the fact that up-regulation of p27KIP1 levels might result from the cooperation of distinctive signaling pathways linked to specific cellular circumstances. In this respect, Hauck et al., showed that hypertrophic stimulation of cardiomyocytes results in induction of CK2α’ activity and progressive proteasomal-mediated degradation of p27KIP1 suggesting that CK2α’ supports hypertrophic signaling by blocking p27KIP1 growth-suppressive functions in non-proliferating cardiomyocytes [68]. Conversely, we found in our study that down-regulation of CK2α was not accompanied by decreased expression of CK2α’, yet, the levels of p27KIP1 were found up-regulated in myoblasts and CK2α-knockout embryos. This supports the notion that the individual CK2 isoforms exert distinct effects according to certain cellular conditions (e.g. differentiation status, growth factors stimulation, cell type, etc.).
It has been shown that degradation of p27KIP1 associated with the transition of cells from G0 to G1/S phase, is mediated by the binding to the F-box protein Skp2 of the SCFSkp2 complex and subsequent ubiquitin-mediated degradation [4, 69, 70]. Hence, it is not to be excluded that up-regulation of p27KIP1 in cells depleted of CK2α could also result from lack of Skp2/p27KIP1 regulation. This is plausible, as CK2 has been shown to play a critical role in polyubiquitination of the promyelocytic leukemia gene product PML [71] and Wee1 [22] in human cancer cells. On the other hand, Hara et al., reported evidence that degradation of p27KIP1 at the G0/G1 transition is mediated by a Skp2-independent ubiquitination pathway [72]. We attempted to investigate the status of Skp2 in our model system based also on our recent findings by RNA-Seq showing lowered Skp2 mRNA levels in cell with silenced CK2α [20]. Unfortunately, Skp2 expression appeared beyond detection levels under the applied experimental conditions making it unlikely to have a significant role in p27KIP1 levels (data not shown). Moreover, we cannot exclude that up-regulation of p27KIP1 might arise from mechanisms independent from Skp2. Data from the literature showed that the Skp2-dependent pathway of p27KIP1 ubiquitination might play a more important role in S and G2 phases rather than in G1 phase [73]. Moreover, Skp2-independent degradation of p27KIP1 has been reported in Skp2-/- cells involving other E3 ligases including KPC1, Pirh2 and DDB1 and possibly other proteins yet to be identified [74]. In many instances high Skp2 expression levels correlate with reduced p27KIP1, however, loss of p27KIP1 seems to occur without increased Skp2 in most tumor types [41]. Finally, it is important to point out that decreased expression of CK2β seen in cells with down-regulation of CK2α, might contribute to regulate the expression of p27KIP1. Tapia et al., reported that p27KIP1 is an in vitro substrate of CK2 and interacts with CK2β and that this phosphorylation event affects its secondary structure [75]. Hence, as p27KIP1 is a CK2-dependent binding partner of CK2β (reviewed in [12]), a role of the latter with respect to modulation of p27KIP1 expression is not to be excluded. Apart from this, it is intriguing the correlation between CK2α depletion and lowered expression of CK2β. Initially reported by Allende and Allende [76], CK2b contains sequences that resemble very closely the destruction box found on several cyclins and that play a role in mediating cell cycle dependent protein degradation (reviewed in [12, 19]). The parallels between CK2b and cyclins is attractive, however, apart from the destruction box, it remains to be further elucidated whether other signals, such as phosphorylation, regulate the stability of CK2b within the CK2 holoenzyme and as an independent CK2 isoform.
In this study, the expression of FoxO3A was found slightly up-regulated in cells with decreased levels of CK2α and preceding the expression of FoxO1. This is in agreement with previous data showing that the level of FoxO1 is low in G0/G1 and then, increases towards G1/S phase while FoxO3A controls the expression of FoxO1 and -4 [77-79]. Moreover, the fact that FoxO1 appears to be strongly expressed in the perinuclear region in cells depleted of CK2α suggests that post-translational modifications may prevent full cytoplasmic translocation as previously reported [80]. In experiments where the phosphorylation status of FoxO3A at S253 was investigated following IGF-1-mediated stimulation of the PI3K/AKT signaling, we showed that dephosphorylation of FoxO3A was accompanied by a significant suppression of AKT phosphorylation at T308 and S129 in cells depleted of CK2α. CK2-mediated phosphorylation of AKT at S129 results in increased association of heat shock protein 90 (HSP90) to AKT preventing dephosphorylation of the latter at the activating T308 in cancer cells. In support of a regulatory role of CK2 with respect to AKT kinase activity, it has been additionally shown that phosphorylation of AKT at T308 decreases when S129 is mutated into alanine [53, 81]. Hence, it is plausible that a similar regulatory mechanism might occur in myoblasts where a general cooperation between CK2α, the PI3K/AKT signaling pathway and FoxO proteins contributes to regulate cell proliferation in the early phase of the cell cycle that will need to be further investigated in the future.
Regardless of the molecular mechanisms by which the levels of p27KIP1 is regulated in cells depleted of CK2α, an important observation that emerged from previous work ([16, 20]) and the present study is that lack of CK2α does not lead to induction of apoptosis in myoblasts. This is in contrast to what has been observed in cancer cells previously investigated (reviewed in [19, 82, 83]). This suggests that non-cancerous cells might not be strictly dependent on the expression of CK2α, at least with respect to cell death mechanisms. However, it is not excluded that a compensatory mechanism mediated by CK2α’ might be activated in the absence of CK2α, as previously observed [84].
We show that cells depleted of CK2α preserve the capacity to proliferate, however, at a slower pace as compared to control cells. This effect might indicate that cells can traverse the cell cycle when conditions for proliferation are limited/critical (e.g. minimal CK2 activity, low expression of proteins normally present at origins of replication and implicated in DNA replication initiation). Up-regulation of p27KIP1, which is seen both in vitro and in vivo, contributes to delay G1-to-S phase transition. However, lack of proliferation potential seen when p27KIP1 is down-regulated, reflects the protective role of p27KIP1 in myoblasts ensuring survival in conditions unfavorable for their growth. Finally, it is not to be excluded that elevated levels of p27KIP1 might be necessary for preventing replicative stress when cells lack CK2α. This is conceivable, as down-regulation of CK2α results in decreased levels of MCM proteins, which constitute the core of the replication origin recognition complex. In support of this, Quereda et al., showed that complete abrogation of KIP1/CIP1 cell cycle inhibitors in mice induce perinatal lethality in the absence of tumors due to high levels of replicative stress [20, 85].
Conclusion
There are still pending questions regarding the model proposed here which links CK2α to the cell cycle machinery in non-cancerous cells. They concern the identity of the multiple post-translational modifications regulating stability, function and cellular localization of p27KIP1 and the possible contribution of additional proteins that regulate the cell transition through G1 phase yet to be identified. Nevertheless, the findings presented here provide novel insights into critical mechanisms, which control cell cycle progression in preparation of DNA replication and indicate that up-regulation of p27KIP1 in cells depleted of CK2α ensure the viability of cells in a microenvironment that limit but is still permissive for growth.
Acknowledgements
We thank Tina H. Svenstrup and Henriette Skovgaard Andersen for excellent technical assistance and Dr. Olaf-Georg Issinger for helpful discussion. We also thank Dr. Susanne Mandrup for the generous gift of anti-E2F antibody.
Author Contributions
BG designed the project, carried out a large part of the experiments, wrote the manuscript and provided financial support. M.D. contributed to results shown in Fig. 5 and Supplementary Fig. S3, M.A.S. and P.C. assisted with cell proliferation experiments using the IncuCyte S3 platform, I.D. supervised in vivo experimental work and assisted with collection of in vivo data, and B.S.A. participated in data analysis and critical discussion of the study.
Funding
This work was supported with funding from The Novo Nordisk Foundation (Grant NNF17OC0028720) to B. Guerra.
Statement of Ethics
Mice experiments were performed in accordance with relevant guidelines and regulations and approved by the Boston University Medical Center Institutional Animal Care and Use Committee (IACUC).
Disclosure Statement
The authors have no conflicts of interests to declare.
References
|
1 Sherr CJ:
Cancer cell cycles. Science 1996;274:1672-1677. |
|
|
|
|
|
2 Morgan DO: The Cell Cycle Principle of Control, New Science Press Ltd, Oxford University Press, 2007, pp 212-214. |
|
|
|
|
|
3 Polyak K, Kato
JY, Solomon MJ, Sherr CJ, Massague J, Roberts JM, et al.: p27Kip1, a
cyclin-Cdk inhibitor, links transforming growth factor-beta and contact
inhibition to cell cycle arrest. Genes Dev 1994;8:9-22. |
|
|
|
|
|
4 Pagano M, Tam
SW, Theodoras AM, Beer-Romero P, Del Sal G, Chau V, et al.: Role of the
ubiquitin-proteasome pathway in regulating abundance of the cyclin-dependent
kinase inhibitor p27. Science 1995;269:682-685. |
|
|
|
|
|
5 Tam SW, Theodoras AM, Pagano M: Kip1 degradation via the ubiquitin-proteasome pathway. Leukemia 1997;11:363-366. |
|
|
|
|
|
6 Hiromura K,
Pippin JW, Fero ML, Roberts JM, Shankland SJ: Modulation of apoptosis by the
cyclin-dependent kinase inhibitor p27(Kip1). J Clin Invest 1999;103:597-604. |
|
|
|
|
|
7 Ishii T,
Fujishiro M, Masuda M, Goshima Y, Kitamura H, Teramoto S, et al.: Effects of
p27Kip1 on cell cycle status and viability in A549 lung adenocarcinoma cells.
Eur Respir J 2004;23:665-670. |
|
|
|
|
|
8 Guerra B,
Issinger OG: Protein kinase CK2 and its role in cellular proliferation,
development and pathology. Electrophoresis 1999;20:391-408. |
|
|
|
|
|
9 St-Denis NA,
Litchfield DW: Protein kinase CK2 in health and disease: From birth to death:
the role of protein kinase CK2 in the regulation of cell proliferation and
survival. Cell Mol Life Sci 2009;66:1817-1829. |
|
|
|
|
|
10 Trembley JH,
Chen Z, Unger G, Slaton J, Kren BT, Van Waes C, et al.: Emergence of protein
kinase CK2 as a key target in cancer therapy. Biofactors 2010;36:187-195. |
|
|
|
|
|
11 Guerra B,
Issinger OG: CK2: a global regulator of cell survival; in Pinna AL (ed):
Protein kinase CK2. Oxford, UK, John Wiley & Sons, Inc., 2013, pp
239-266. |
|
|
|
|
|
12 Bibby AC,
Litchfield DW: The multiple personalities of the regulatory subunit of
protein kinase CK2: CK2 dependent and CK2 independent roles reveal a secret
identity for CK2beta. Int J Biol Sci 2005;1:67-79. |
|
|
|
|
|
13 Faust M, Jung
M, Gunther J, Zimmermann R, Montenarh M: Localization of individual subunits
of protein kinase CK2 to the endoplasmic reticulum and to the Golgi
apparatus. Mol Cell Biochem 2001;227:73-80. |
|
|
|
|
|
14 Filhol O,
Nueda A, Martel V, Gerber-Scokaert D, Benitez MJ, Souchier C, et al.:
Live-cell fluorescence imaging reveals the dynamics of protein kinase CK2
individual subunits. Mol Cell Biol 2003;23:975-987. |
|
|
|
|
|
15 Olsen BB,
Guerra B: Ability of CK2beta to selectively regulate cellular protein
kinases. Mol Cell Biochem 2008;316:115-126. |
|
|
|
|
|
16 Lou DY,
Dominguez I, Toselli P, Landesman-Bollag E, O'Brien C, Seldin DC: The alpha
catalytic subunit of protein kinase CK2 is required for mouse embryonic
development. Mol Cell Biol 2008;28:131-139. |
|
|
|
|
|
17 Xu X, Toselli
PA, Russell LD, Seldin DC: Globozoospermia in mice lacking the casein kinase
II alpha' catalytic subunit. Nat Genet 1999;23:118-121. |
|
|
|
|
|
18 Buchou T,
Vernet M, Blond O, Jensen HH, Pointu H, Olsen BB, et al.: Disruption of the
regulatory beta subunit of protein kinase CK2 in mice leads to a
cell-autonomous defect and early embryonic lethality. Mol Cell Biol
2003;23:908-915. |
|
|
|
|
|
19 Litchfield DW:
Protein kinase CK2: structure, regulation and role in cellular decisions of
life and death. Biochem J 2003;369:1-15. |
|
|
|
|
|
20 Schaefer S,
Doktor TK, Frederiksen SB, Chea K, Hlavacova M, Bruun GH, et al.:
Down-regulation of CK2alpha correlates with decreased expression levels of
DNA replication minichromosome maintenance protein complex (MCM) genes. Sci
Rep 2019;9:14581. |
|
|
|
|
|
21 Guerra B,
Iwabuchi K, Issinger OG: Protein kinase CK2 is required for the recruitment
of 53BP1 to sites of DNA double-strand break induced by radiomimetic drugs.
Cancer Lett 2014;345:115-123. |
|
|
|
|
|
22 Yde CW, Olsen
BB, Meek D, Watanabe N, Guerra B: The regulatory beta-subunit of protein
kinase CK2 regulates cell-cycle progression at the onset of mitosis. Oncogene
2008;27:4986-4997. |
|
|
|
|
|
23 Guerra B, Siemer
S, Boldyreff B, Issinger OG: Protein kinase CK2: evidence for a protein
kinase CK2beta subunit fraction, devoid of the catalytic CK2alpha subunit, in
mouse brain and testicles. FEBS Lett 1999;462:353-357. |
|
|
|
|
|
24 Guerra B,
Fischer M, Schaefer S, Issinger OG: The kinase inhibitor D11 induces
caspase-mediated cell death in cancer cells resistant to chemotherapeutic
treatment. J Exp Clin Cancer Res 2015;34:125. |
|
|
|
|
|
25 Zarkowska T,
Mittnacht S: Differential phosphorylation of the retinoblastoma protein by
G1/S cyclin-dependent kinases. J Biol Chem 1997;272:12738-12746. |
|
|
|
|
|
26 Ikegami S,
Taguchi T, Ohashi M, Oguro M, Nagano H, Mano Y: Aphidicolin prevents mitotic
cell division by interfering with the activity of DNA polymerase-alpha.
Nature 1978;275:458-460. |
|
|
|
|
|
27 Wang TS:
Eukaryotic DNA polymerases. Annu Rev Biochem 1991;60:513-552. |
|
|
|
|
|
28 Dyson N: The regulation of E2F by pRB-family proteins. Genes Dev 1998;12:2245-2262. |
|
|
|
|
|
29 Knudsen ES,
Buckmaster C, Chen TT, Feramisco JR, Wang JY: Inhibition of DNA synthesis by
RB: effects on G1/S transition and S-phase progression. Genes Dev
1998;12:2278-2292. |
|
|
|
|
|
30 Sellers WR,
Novitch BG, Miyake S, Heith A, Otterson GA, Kaye FJ, et al.: Stable binding
to E2F is not required for the retinoblastoma protein to activate
transcription, promote differentiation, and suppress tumor cell growth. Genes
Dev 1998;12:95-106. |
|
|
|
|
|
31 Whitaker LL,
Su H, Baskaran R, Knudsen ES, Wang JY: Growth suppression by an
E2F-binding-defective retinoblastoma protein (RB): contribution from the RB C
pocket. Mol Cell Biol 1998;18:4032-4042. |
|
|
|
|
|
32 Ishimi Y: A
DNA helicase activity is associated with an MCM4, -6, and -7 protein complex.
J Biol Chem 1997;272:24508-24513. |
|
|
|
|
|
33 Leone G,
DeGregori J, Yan Z, Jakoi L, Ishida S, Williams RS, et al.: E2F3 activity is
regulated during the cell cycle and is required for the induction of S phase.
Genes Dev 1998;12:2120-2130. |
|
|
|
|
|
34 Ohtani K,
Iwanaga R, Nakamura M, Ikeda M, Yabuta N, Tsuruga H, et al.: Cell
growth-regulated expression of mammalian MCM5 and MCM6 genes mediated by the
transcription factor E2F. Oncogene 1999;18:2299-2309. |
|
|
|
|
|
35 Burkhart DL,
Wirt SE, Zmoos AF, Kareta MS, Sage J: Tandem E2F binding sites in the
promoter of the p107 cell cycle regulator control p107 expression and its
cellular functions. PLoS Genet 2010;6:e1001003. |
|
|
|
|
|
36 Arata Y,
Fujita M, Ohtani K, Kijima S, Kato JY: Cdk2-dependent and -independent
pathways in E2F-mediated S phase induction. J Biol Chem 2000;275:6337-6345. |
|
|
|
|
|
37 Otto T,
Sicinski P: Cell cycle proteins as promising targets in cancer therapy. Nat
Rev Cancer 2017;17:93-115. |
|
|
|
|
|
38 Cheng M,
Olivier P, Diehl JA, Fero M, Roussel MF, Roberts JM, et al.: The p21(Cip1)
and p27(Kip1) CDK 'inhibitors' are essential activators of cyclin D-dependent
kinases in murine fibroblasts. EMBO J 1999;18:1571-1583. |
|
|
|
|
|
39 Sherr CJ,
Roberts JM: CDK inhibitors: positive and negative regulators of G1-phase
progression. Genes Dev 1999;13:1501-1512. |
|
|
|
|
|
40 Donjerkovic D,
Scott DW: Regulation of the G1 phase of the mammalian cell cycle. Cell Res
2000;10:1-16. |
|
|
|
|
|
41 Chu IM, Hengst
L, Slingerland JM: The Cdk inhibitor p27 in human cancer: prognostic
potential and relevance to anticancer therapy. Nat Rev Cancer 2008;8:253-267. |
|
|
|
|
|
42 Ishida N,
Kitagawa M, Hatakeyama S, Nakayama K: Phosphorylation at serine 10, a major
phosphorylation site of p27(Kip1), increases its protein stability. J Biol
Chem 2000;275:25146-25154. |
|
|
|
|
|
43 Besson A,
Gurian-West M, Chen X, Kelly-Spratt KS, Kemp CJ, Roberts JM: A pathway in
quiescent cells that controls p27Kip1 stability, subcellular localization,
and tumor suppression. Genes Dev 2006;20:47-64. |
|
|
|
|
|
44 Vervoorts J,
Luscher B: Post-translational regulation of the tumor suppressor p27(KIP1).
Cell Mol Life Sci 2008;65:3255-3264. |
|
|
|
|
|
45 Sun C, Wang G, Wrighton KH, Lin H, Songyang Z, Feng XH, et al.: Regulation of p27(Kip1) phosphorylation and G1 cell cycle progression by protein phosphatase PPM1G. Am J Cancer Res 2016;6:2207-2220. |
|
|
|
|
|
46 Rodier G,
Montagnoli A, Di Marcotullio L, Coulombe P, Draetta GF, Pagano M, et al.: p27
cytoplasmic localization is regulated by phosphorylation on Ser10 and is not
a prerequisite for its proteolysis. EMBO J 2001;20:6672-6682. |
|
|
|
|
|
47 Haberichter T,
Madge B, Christopher RA, Yoshioka N, Dhiman A, Miller R, et al.: A systems
biology dynamical model of mammalian G1 cell cycle progression. Mol Syst Biol
2007;3:84. |
|
|
|
|
|
48 Link W,
Fernandez-Marcos PJ: FOXO transcription factors at the interface of
metabolism and cancer. Int J Cancer 2017;141:2379-2391. |
|
|
|
|
|
49 Huang H,
Tindall DJ: Dynamic FoxO transcription factors. J Cell Sci
2007;120:2479-2487. |
|
|
|
|
|
50 Medema RH,
Kops GJ, Bos JL, Burgering BM: AFX-like Forkhead transcription factors
mediate cell-cycle regulation by Ras and PKB through p27kip1 Nature
2000;404:782-787. |
|
|
|
|
|
51 Morishita D,
Katayama R, Sekimizu K, Tsuruo T, Fujita N: Pim kinases promote cell cycle
progression by phosphorylating and down-regulating p27Kip1 at the
transcriptional and posttranscriptional levels. Cancer Res 2008;68:5076-5085. |
|
|
|
|
|
52 Furukawa-Hibi Y, Kobayashi Y, Chen C, Motoyama N: FOXO transcription factors in cell-cycle regulation and the response to oxidative stress. Antioxid Redox Signal 2005;7:752-760. |
|
|
|
|
|
53 Di Maira G,
Salvi M, Arrigoni G, Marin O, Sarno S, Brustolon F, et al.: Protein kinase
CK2 phosphorylates and upregulates Akt/PKB. Cell Death Differ
2005;12:668-677. |
|
|
|
|
|
54 McNamara CR,
Degterev A: Small-molecule inhibitors of the PI3K signaling network. Future
Med Chem 2011;3:549-565. |
|
|
|
|
|
55 Deng X, Mercer
SE, Shah S, Ewton DZ, Friedman E: The cyclin-dependent kinase inhibitor
p27Kip1 is stabilized in G(0) by Mirk/dyrk1B kinase. J Biol Chem
2004;279:22498-22504. |
|
|
|
|
|
56 Kossatz U, Vervoorts
J, Nickeleit I, Sundberg HA, Arthur JS, Manns MP, et al.: C-terminal
phosphorylation controls the stability and function of p27kip1. EMBO J
2006;25:5159-5170. |
|
|
|
|
|
57 Xu N, Lao Y,
Zhang Y, Gillespie DA: Akt: a double-edged sword in cell proliferation and
genome stability. J Oncol 2012;2012:951724. |
|
|
|
|
|
58 Ewton DZ, Hu
J, Vilenchik M, Deng X, Luk KC, Polonskaia A, et al.: Inactivation of
mirk/dyrk1b kinase targets quiescent pancreatic cancer cells. Mol Cancer Ther
2011;10:2104-2114. |
|
|
|
|
|
59 Zhou G, Myers
R, Li Y, Chen Y, Shen X, Fenyk-Melody J, et al.: Role of AMP-activated
protein kinase in mechanism of metformin action. J Clin Invest
2001;108:1167-1174. |
|
|
|
|
|
60 Liang J, Shao
SH, Xu ZX, Hennessy B, Ding Z, Larrea M, et al.: The energy sensing LKB1-AMPK
pathway regulates p27(kip1) phosphorylation mediating the decision to enter
autophagy or apoptosis. Nat Cell Biol 2007;9:218-224. |
|
|
|
|
|
61 Short JD, Dere
R, Houston KD, Cai SL, Kim J, Bergeron JM, et al.: AMPK-mediated
phosphorylation of murine p27 at T197 promotes binding of 14-3-3 proteins and
increases p27 stability. Mol Carcinog 2010;49:429-439. |
|
|
|
|
|
62 Masuda A,
Osada H, Yatabe Y, Kozaki K, Tatematsu Y, Takahashi T, et al.: Protective
function of p27(KIP1) against apoptosis in small cell lung cancer cells in
unfavorable microenvironments. Am J Pathol 2001;158:87-96. |
|
|
|
|
|
63 Chatterjee A,
Chatterjee U, Ghosh MK: Activation of protein kinase CK2 attenuates FOXO3a
functioning in a PML-dependent manner: implications in human prostate cancer.
Cell Death Dis 2013;4:e543. |
|
|
|
|
|
64 De Vita F,
Riccardi M, Malanga D, Scrima M, De Marco C, Viglietto G: PKC-dependent
phosphorylation of p27 at T198 contributes to p27 stabilization and cell
cycle arrest. Cell Cycle 2012;11:1583-1592. |
|
|
|
|
|
65 Larrea MD,
Liang J, Da Silva T, Hong F, Shao SH, Han K, et al.: Phosphorylation of
p27Kip1 regulates assembly and activation of cyclin D1-Cdk4. Mol Cell Biol
2008;28:6462-6472. |
|
|
|
|
|
66 Nakamura S,
Okinaka K, Hirano I, Ono T, Sugimoto Y, Shigeno K, et al.: KIS induces proliferation
and the cell cycle progression through the phosphorylation of p27Kip1 in
leukemia cells. Leuk Res 2008;32:1358-1365. |
|
|
|
|
|
67 Dixit D, Ahmad
F, Ghildiyal R, Joshi SD, Sen E: CK2 inhibition induced PDK4-AMPK axis
regulates metabolic adaptation and survival responses in glioma. Exp Cell Res
2016;344:132-142. |
|
|
|
|
|
68 Hauck L, Harms
C, An J, Rohne J, Gertz K, Dietz R, et al.: Protein kinase CK2 links
extracellular growth factor signaling with the control of p27(Kip1) stability
in the heart. Nat Med 2008;14:315-324. |
|
|
|
|
|
69 Ishida N, Hara
T, Kamura T, Yoshida M, Nakayama K, Nakayama KI: Phosphorylation of p27Kip1
on serine 10 is required for its binding to CRM1 and nuclear export. J Biol
Chem 2002;277:14355-14358. |
|
|
|
|
|
70
Tamamori-Adachi M, Hayashida K, Nobori K, Omizu C, Yamada K, Sakamoto N, et
al.: Down-regulation of p27Kip1 promotes cell proliferation of rat neonatal
cardiomyocytes induced by nuclear expression of cyclin D1 and CDK4 Evidence
for impaired Skp2-dependent degradation of p27 in terminal differentiation. J
Biol Chem 2004;279:50429-50436. |
|
|
|
|
|
71 Scaglioni PP,
Yung TM, Cai LF, Erdjument-Bromage H, Kaufman AJ, Singh B, et al.: A
CK2-dependent mechanism for degradation of the PML tumor suppressor. Cell
2006;126:269-283. |
|
|
|
|
|
72 Hara T, Kamura T, Nakayama K, Oshikawa K, Hatakeyama S, Nakayama K: Degradation of p27(Kip1) at the G(0)-G(1) transition mediated by a Skp2-independent ubiquitination pathway. J Biol Chem 2001;276:48937-48943. |
|
|
|
|
|
73 Nakayama K,
Nagahama H, Minamishima YA, Miyake S, Ishida N, Hatakeyama S, et al.:
Skp2-mediated degradation of p27 regulates progression into mitosis. Dev Cell
2004;6:661-672. |
|
|
|
|
|
74 Kotoshiba S,
Gopinathan L, Pfeiffenberger E, Rahim A, Vardy LA, Nakayama K, et al.: p27 is
regulated independently of Skp2 in the absence of Cdk2. Biochim Biophys Acta
2014;1843:436-445. |
|
|
|
|
|
75 Tapia JC,
Bolanos-Garcia VM, Sayed M, Allende CC, Allende JE: Cell cycle regulatory
protein p27KIP1 is a substrate and interacts with the protein kinase CK2. J
Cell Biochem 2004;91:865-879. |
|
|
|
|
|
76 Allende JE,
Allende CC: Protein kinase CK2: an enzyme with multiple substrates and a
puzzling regulation. FASEB J 1995;9:313-323. |
|
|
|
|
|
77 Essaghir A,
Dif N, Marbehant CY, Coffer PJ, Demoulin JB: The transcription of FOXO genes
is stimulated by FOXO3 and repressed by growth factors. J Biol Chem
2009;284:10334-10342. |
|
|
|
|
|
78 Zhou J, Liao
W, Yang J, Ma K, Li X, Wang Y, et al.: FOXO3 induces FOXO1-dependent
autophagy by activating the AKT1 signaling pathway. Autophagy
2012;8:1712-1723. |
|
|
|
|
|
79 Das TP, Suman
S, Alatassi H, Ankem MK, Damodaran C: Inhibition of AKT promotes
FOXO3a-dependent apoptosis in prostate cancer. Cell Death Dis 2016;7:e2111. |
|
|
|
|
|
80 Prasad SB,
Yadav SS, Das M, Govardhan HB, Pandey LK, Singh S, et al.: Down Regulation of
FOXO1 Promotes Cell Proliferation in Cervical Cancer. J Cancer
2014;5:655-662. |
|
|
|
|
|
81 Di Maira G,
Brustolon F, Pinna LA, Ruzzene M: Dephosphorylation and inactivation of
Akt/PKB is counteracted by protein kinase CK2 in HEK 293T cells. Cell Mol
Life Sci 2009;66:3363-3373. |
|
|
|
|
|
82 Guerra B,
Issinger OG: Protein kinase CK2 in human diseases. Curr Med Chem
2008;15:1870-1886. |
|
|
|
|
|
83 Venerando A, Ruzzene M, Pinna LA: Casein kinase: the triple meaning of a misnomer. Biochem J 2014;460:141-156. |
|
|
|
|
|
84
Landesman-Bollag E, Belkina A, Hovey B, Connors E, Cox C, Seldin DC:
Developmental and growth defects in mice with combined deficiency of CK2
catalytic genes. Mol Cell Biochem 2011;356:227-231. |
|
|
|
|
|
85 Quereda V,
Porlan E, Canamero M, Dubus P, Malumbres M: An essential role for Ink4 and
Cip/Kip cell-cycle inhibitors in preventing replicative stress. Cell Death
Differ 2016;23:430-441. |
|